ROUGE

Gene/Protein Characteristic Table for mKIAA4106

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220287
Description :	Cullin homolog 2.
Clone Name :	mid05034 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2822 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 414 bp

Genome contig ID gi65551972f_3287955
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAATGACAAACATGATGTTGCTGCTTGTCAAAT
Flanking genome sequence
(152023 - 152072)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATAAGCATAATGCCTTTTTCTATGATGACGGAATAT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 162..2405
Length: 748 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9D4H8	100.0	Cullin-2; Short...	Mus musculus
EAW85927	97.3	hCG2017221, iso...	Homo sapiens
EAW85922	97.3	hCG2040100 [Hom...	Homo sapiens
BAH13294	97.2	unnamed protein...	Homo sapiens
Q13617	97.3	Cullin-2; Short...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC029260	2e-84	36.2	mKIAA4122
AK129174	1.4e-32	27.6	mKIAA0617
AB093259	6.1e-20	27.0	mKIAA0695
AK129351	1.2e-05	23.8	mKIAA1406

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001373 17 648 PF00888 Cullin

HMMSmart IPR001373 419 571 SM00182 Cullin

ProfileScan IPR001373 389 621 PS50069 Cullin

ScanRegExp IPR001373 721 748 PS01256 Cullin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	17	648	PF00888	Cullin
HMMSmart	IPR001373	419	571	SM00182	Cullin
ProfileScan	IPR001373	389	621	PS50069	Cullin
ScanRegExp	IPR001373	721	748	PS01256	Cullin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	414 bp
Genome contig ID	gi65551972f_3287955
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAATGACAAACATGATGTTGCTGCTTGTCAAAT
Flanking genome sequence (152023 - 152072)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATAAGCATAATGCCTTTTTCTATGATGACGGAATAT

Gene/Protein Characteristic Table for mKIAA4106

Features of the cloned DNA sequence

Features of the protein sequence