ROUGE

Gene/Protein Characteristic Table for mKIAA1406

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129351
Description :	Anaphase promoting complex subunit 2.
Clone Name :	mph00927 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2660 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 143 bp

Genome contig ID gi66880554f_25104736
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CACCCACAGAACAAATTAAAGCATATTGGCTCATC
Flanking genome sequence
(113035 - 113084)
----+----*----+----*----+----*----+----*----+----*
CTTTCATGTATTTTGTTGGATCCCATGAATACAAACAGGTTTGCCCTCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1406 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1406	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2517
Length: 838 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE41951	100.0	unnamed protein...	Mus musculus
Q8BZQ7	99.9	Anaphase-promot...	Mus musculus
AAH27351	100.0	Anapc2 protein ...	Mus musculus
BAE32605	99.5	unnamed protein...	Mus musculus
EDL93618	97.8	anaphase promot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC029260	2.1e-06	20.0	mKIAA4122
AK220287	5.3e-06	23.8	mKIAA4106
AB093259	0.00074	25.8	mKIAA0695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001373 337 751 PF00888 Cullin

HMMSmart IPR001373 516 664 SM00182 Cullin

ProfileScan NULL 4 24 PS50310 NULL

IPR001373 518 716 PS50069 Cullin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	337	751	PF00888	Cullin
HMMSmart	IPR001373	516	664	SM00182	Cullin
ProfileScan	NULL	4	24	PS50310	NULL
IPR001373	518	716	PS50069	Cullin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	143 bp
Genome contig ID	gi66880554f_25104736
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CACCCACAGAACAAATTAAAGCATATTGGCTCATC
Flanking genome sequence (113035 - 113084)	----+--------+--------+--------+--------+----* CTTTCATGTATTTTGTTGGATCCCATGAATACAAACAGGTTTGCCCTCTA

Gene/Protein Characteristic Table for mKIAA1406

Features of the cloned DNA sequence

Features of the protein sequence