ROUGE |
Gene/Protein Characteristic Table for mKIAA4089 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220481 |
---|---|
brain-specific angiogenesis inhibitor 1. | |
mbg12616 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5621 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 580 bp Genome contig ID gi65543215f_74460591 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CTTTTCTTTTCTTCAATAAAAAGAATTAAAAACCCFlanking genome sequence
(160538 - 160587) ----+----*----+----*----+----*----+----*----+----*
AGCTTTGTAGTCTTTTTTTTTTTTCCTGAAGCAGCATGGTTCTATTTCAG
Features of the protein sequence |
Description | |
Coding region: 1286..5038
Length: 1251 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |