ROUGE

Gene/Protein Characteristic Table for mKIAA4046

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220172
Description :	restin. cytoplasmic linker protein 50. Reed-Steinberg cell-espressed intermediate filament-associated protein.
Clone Name :	mpm06238 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5605 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1478 bp

Genome contig ID gi65498774r_122648047
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTATCTACTTTAATAAATGTTTTGGGTCTCTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTTGGTTGGTTGGTTTTTGGCAGTGGTAGTAAACACATAATATTCTTAGG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 168..4124
Length: 1319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_859497	88.3	similar to rest...	Canis lupus fam...
NP_113933	90.1	restin [Rattus ...	Rattus norvegicus
CAB92974	90.0	CLIP-170 [Rattu...	Rattus norvegicus
XP_001097802	86.0	restin (Reed-St...	Macaca mulatta
XP_001167071	85.9	similar to rest...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172928	9.2e-14	34.0	mKIAA0291
AK131171	1.1e-06	22.4	mFLJ00279
AK173203	1.8e-06	21.4	mKIAA1561
AK122578	1e-05	22.2	mKIAA3005
AK172988	1.3e-05	22.1	mKIAA0635

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000938 64 129 PF01302 CAP-Gly

IPR000938 217 282 PF01302 CAP-Gly

ProfileScan IPR000938 82 124 PS50245 CAP-Gly

IPR000938 235 277 PS50245 CAP-Gly

NULL 309 334 PS50324 NULL

ScanRegExp IPR000938 82 113 PS00845 CAP-Gly

IPR000938 235 266 PS00845 CAP-Gly

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000938	64	129	PF01302	CAP-Gly
IPR000938	217	282	PF01302	CAP-Gly
ProfileScan	IPR000938	82	124	PS50245	CAP-Gly
IPR000938	235	277	PS50245	CAP-Gly
NULL	309	334	PS50324	NULL
ScanRegExp	IPR000938	82	113	PS00845	CAP-Gly
IPR000938	235	266	PS00845	CAP-Gly

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1478 bp
Genome contig ID	gi65498774r_122648047
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTATCTACTTTAATAAATGTTTTGGGTCTCTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GTTGGTTGGTTGGTTTTTGGCAGTGGTAGTAAACACATAATATTCTTAGG

Gene/Protein Characteristic Table for mKIAA4046

Features of the cloned DNA sequence

Features of the protein sequence