ROUGE

Gene/Protein Characteristic Table for mKIAA1561

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173203
Description :	nuclear membrane binding protein NUCLING.
Clone Name :	mej02373 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 4493 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 118 bp

Genome contig ID gi65519420f_60879959
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ATCAGTAAAATAAACTATATTTTGTTCCGTTGTTG
Flanking genome sequence
(117495 - 117544)
----+----*----+----*----+----*----+----*----+----*
AATTTTACTTTTCTGAGATGAGTGTGTCACCGAGTTTTCCAGTGGATTAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1561 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1561	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1055..4375
Length: 1106 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH42415	96.7	Uveal autoantig...	Mus musculus
EDL26004	96.7	uveal autoantig...	Mus musculus
Q8CGB3	96.4	Uveal autoantig...	Mus musculus
EDL95724	92.0	rCG57880, isofo...	Rattus norvegicus
XP_001073577	92.0	similar to nucl...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129333	1.8e-11	27.1	mKIAA1334
AK122578	7.7e-08	22.7	mKIAA3005
AK173045	1.3e-06	23.1	mKIAA0866
AK220172	1.6e-06	21.4	mKIAA4046
AK172988	1.8e-06	21.8	mKIAA0635

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000727 1008 1070 PS50192 Target SNARE coiled-coil region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000727	1008	1070	PS50192	Target SNARE coiled-coil region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	118 bp
Genome contig ID	gi65519420f_60879959
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ATCAGTAAAATAAACTATATTTTGTTCCGTTGTTG
Flanking genome sequence (117495 - 117544)	----+--------+--------+--------+--------+----* AATTTTACTTTTCTGAGATGAGTGTGTCACCGAGTTTTCCAGTGGATTAA

Gene/Protein Characteristic Table for mKIAA1561

Features of the cloned DNA sequence

Features of the protein sequence