ROUGE

Gene/Protein Characteristic Table for mKIAA2027

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173336
Description :
Clone Name :	mbg08063 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 7369 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4833 bp

Genome contig ID gi65504368r_59493900
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACAAACAAGAGACAATCTGGAAAAGACTTACTATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGCAAGGTGACAGCAATTATAAAGGACATACAAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2027 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2027	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 83..2536
Length: 817 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BWS5	0	100.0	G protein-regul...	Mus musculus
EDL88021	7.8e-209	80.6	rCG52360 [Rattu...	Rattus norvegicus
XP_001101149	5.2e-111	58.7	hypothetical pr...	Macaca mulatta
EAX06032	5.9e-110	58.5	hypothetical pr...	Homo sapiens
Q6ZVF9	1.1e-109	58.3	G protein-regul...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC057044	3.6e-07	22.6	mKIAA1893

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4833 bp
Genome contig ID	gi65504368r_59493900
PolyA signal sequence (None)	+--------+--------+----*----+---- ACAAACAAGAGACAATCTGGAAAAGACTTACTATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGCAAGGTGACAGCAATTATAAAGGACATACAAAT

Gene/Protein Characteristic Table for mKIAA2027

Features of the cloned DNA sequence

Features of the protein sequence