ROUGE

Gene/Protein Characteristic Table for mKIAA1893

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC057044
Description :
Clone Name :	mfj37191 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4072 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 988 bp

Genome contig ID gi65535943r_53247818
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GTCACAGTATACATTGGTAATAAAAACCTTTCCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTCTTGTCTATGATTGACAAGCAAGGCCATATATTATATTTTAGGGGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1893 DNA sequence, Physical map

KIAA	Alignment based on:
KIAA1893	DNA sequence, Physical map

Features of the protein sequence	Description

Coding region: 175..3081
Length: 969 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q3UNH4	0	100.0	G protein-regul...	Mus musculus
BAE25773	0	99.9	unnamed protein...	Mus musculus
AAD55371	0	99.9	GRIN1 [Mus musc...	Mus musculus
XP_001476403	1.6e-184	83.0	similar to Gpri...	Mus musculus
XP_344572	9.6e-158	81.6	similar to G pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173336	0.00023	23.4	mKIAA2027

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	988 bp
Genome contig ID	gi65535943r_53247818
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GTCACAGTATACATTGGTAATAAAAACCTTTCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTCTTGTCTATGATTGACAAGCAAGGCCATATATTATATTTTAGGGGA

Gene/Protein Characteristic Table for mKIAA1893

Features of the cloned DNA sequence

Features of the protein sequence