ROUGE |
Gene/Protein Characteristic Table for mKIAA2023 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC055003 |
---|---|
SNF2 histone linker PHD RING helicase. | |
mtg03092 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6863 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1727 bp Genome contig ID gi65524842f_10927603 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATACCTCAATTAAATAAATATTTTAGTGGAAAATGFlanking genome sequence
(165783 - 165832) ----+----*----+----*----+----*----+----*----+----*
AAATTATGGATTGTTTTATTTCTAAGGTTTAGATCATATGAACTTTGGTT
KIAA Alignment based on: KIAA2023 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 73..5136
Length: 1687 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |