ROUGE

Gene/Protein Characteristic Table for mKIAA1963

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220433
Description :	Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2.
Clone Name :	mfj52228 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4998 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3406 bp

Genome contig ID gi65488608f_23907163
PolyA signal sequence
(CATAAA,-33)
+----*----+----*----+----*----+----
CCCATAAACACACCTGTATTGTAAGAACCATGAAT
Flanking genome sequence
(186577 - 186626)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAGAACAGGTCAAGAAGAGGCTCTTTATATGGCTGCACTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1963 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1963	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 543..1592
Length: 349 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P59270	9.9e-132	100.0	Galactosylgalac...	Mus musculus
BAC20343	2.1e-131	99.7	UDP-glucuronylt...	Mus musculus
Q9Z137	1.6e-130	98.5	Galactosylgalac...	Rattus norvegicus
Q9NPZ5	5.7e-117	90.4	Galactosylgalac...	Homo sapiens
Q5CAZ6	6.3e-115	89.7	Galactosylgalac...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220561	2e-47	49.4	mKIAA4235

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005027 127 334 PF03360 Glycosyl transferase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 29 50 ALCSRFFILLPWILIVIIMLDV

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005027	127	334	PF03360	Glycosyl transferase

Method	From	To	amino acid sequence
SOSUI	29	50	ALCSRFFILLPWILIVIIMLDV

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3406 bp
Genome contig ID	gi65488608f_23907163
PolyA signal sequence (CATAAA,-33)	+--------+--------+----*----+---- CCCATAAACACACCTGTATTGTAAGAACCATGAAT
Flanking genome sequence (186577 - 186626)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAGAACAGGTCAAGAAGAGGCTCTTTATATGGCTGCACTC

Gene/Protein Characteristic Table for mKIAA1963

Features of the cloned DNA sequence

Features of the protein sequence