KIAA1963

Product ID	ORK00959
Accession No	AB075843
Description	beta-1,3-glucuronyltransferase 2
Clone name	ph00179
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6031 bp) Predicted protein sequence (488 aa)
HaloTag ORF Clone	FHC00959
Flexi ORF Clone	FXC00959
Source	Human brain (hippocampus)
Rouge ID	mKIAA1963 by Kazusa Mouse cDNA Project

Length: 6031 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4450 bp
Genome contig ID	gi89161210r_71523637
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCTTGTTAATTCCAAATAAAGTTCTGTGAATCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TACATGCCTCTTAATTTTTTAATTCTAATGCTCATTCATTTCGGCTTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	71623637	71723462	4	99.2	Perfect prediction

Length: 488 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9NPZ5	2.7e-107	100.0	Galactosylgalac...	Homo sapiens
Q5CAZ6	2.1e-101	94.5	Galactosylgalac...	Canis lupus fam...
CAI68026	8e-100	92.6	beta-3-glucuron...	Bos taurus
P59270	1.4e-95	90.4	Galactosylgalac...	Mus musculus
BAC20343	2.7e-95	90.1	UDP-glucuronylt...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	166	265	PD865536	NULL
HMMPfam	IPR005027	266	473	PF03360	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	167	KSALFTRFFILLPWILIVIIMLD	189	PRIMARY	23

Primer_f	AACACCTATAGTCTGGAGCTC
Primer_r	ATCCACGACGCTTAAATACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-