Order Kazusa clone(s) from : ![]() |
Product ID | ORK00959 |
---|---|
Accession No | AB075843 |
Description | beta-1,3-glucuronyltransferase 2 |
Clone name | ph00179 |
Vector information | |
cDNA sequence | DNA sequence (6031 bp) Predicted protein sequence (488 aa) |
HaloTag ORF Clone |
FHC00959
![]() |
Flexi ORF Clone | FXC00959 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1963
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4450 bp |
---|---|
Genome contig ID | gi89161210r_71523637 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 71623637 | 71723462 | 4 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 166 | 265 | PD865536 | NULL |
HMMPfam | IPR005027 | 266 | 473 | PF03360 | Glycosyl transferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 167 | KSALFTRFFILLPWILIVIIMLD | 189 | PRIMARY | 23 |
---|
![]() |
Primer_f | AACACCTATAGTCTGGAGCTC |
---|---|
Primer_r | ATCCACGACGCTTAAATACAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |