ROUGE

Gene/Protein Characteristic Table for mKIAA1881

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173286
Description :	plasma membrane associated protein, S3-12. S3-12 protein.
Clone Name :	mtg02633 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 4483 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1817 bp

Genome contig ID gi65550231r_53638691
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
ACCTAAGCCAATAAAAGCTGTTTCTTTTTCATTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATTCTTTATAGCCATTTCATGTCAATTGAAATCACAGAACTAGGCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1881 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1881	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2660, 2672..3067
Length: 1017 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_065593	0	71.4	plasma membrane...	Mus musculus
EDL23717	0	71.4	plasma membrane...	Mus musculus
XP_854446	1.1e-122	56.6	similar to plas...	Canis lupus fam...
XP_001082322	1.6e-122	56.9	similar to plas...	Macaca mulatta
EAW69214	6.6e-120	55.7	hCG1646516 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122449	2.4e-08	24.0	mKIAA1114

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 176 654 PS50325 NULL

ScanRegExp IPR002173 220 243 PS00583 Carbohydrate kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	176	654	PS50325	NULL
ScanRegExp	IPR002173	220	243	PS00583	Carbohydrate kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1817 bp
Genome contig ID	gi65550231r_53638691
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ACCTAAGCCAATAAAAGCTGTTTCTTTTTCATTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTCTTTATAGCCATTTCATGTCAATTGAAATCACAGAACTAGGCAG

Gene/Protein Characteristic Table for mKIAA1881

Features of the cloned DNA sequence

Features of the protein sequence