ROUGE

Gene/Protein Characteristic Table for mKIAA1823

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122560
Description :	PHD finger protein 6.
Clone Name :	mbh00306 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4331 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3037 bp

Genome contig ID gi66880665f_47333081
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATACTATTCATTCAATAAATGAGTTCTGGATTTC
Flanking genome sequence
(144660 - 144709)
----+----*----+----*----+----*----+----*----+----*
AGGTCTGTGTCTGCTTTGTAAAAGTGTGTATCGGGTTATTTGTACCAGCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1823 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1823	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 164..1294
Length: 376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9D4J7	6.6e-152	100.0	PHD finger prot...	Mus musculus
EDL84495	1.7e-150	99.2	rCG47045, isofo...	Rattus norvegicus
Q8IWS0	2.6e-148	97.3	PHD finger prot...	Homo sapiens
XP_852628	4.6e-148	97.0	similar to PHD ...	Canis lupus fam...
Q08DR0	4.6e-148	97.0	PHD finger prot...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129332	7.7e-10	33.3	mKIAA1333
AK220457	3.1e-06	24.7	mKIAA4050
AB093223	1.1e-05	24.5	mKIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001965 93 144 SM00249 Zinc finger

IPR001965 291 342 SM00249 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001965	93	144	SM00249	Zinc finger
IPR001965	291	342	SM00249	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3037 bp
Genome contig ID	gi66880665f_47333081
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATACTATTCATTCAATAAATGAGTTCTGGATTTC
Flanking genome sequence (144660 - 144709)	----+--------+--------+--------+--------+----* AGGTCTGTGTCTGCTTTGTAAAAGTGTGTATCGGGTTATTTGTACCAGCA

Gene/Protein Characteristic Table for mKIAA1823

Features of the cloned DNA sequence

Features of the protein sequence