| ROUGE |
Gene/Protein Characteristic Table for mKIAA4050 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220457 |
|---|---|
| Zinc finger protein HRX (Fragment). | |
| mbg07005 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5429 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1292 bp Genome contig ID gi65519420r_44692311 PolyA signal sequence
(AATAAA,-18)
TAAGTGATAGTTTAATTAATAAACATGTCAAGTTTFlanking genome sequence
(99909 - 99860)
ATTGCTGCACTCTGCTGAGCTTCCTTTGGCCTTGGGGGTGGAGTGGGGGA
Features of the protein sequence |
Description | |
Coding region: 1849..4134
Length: 762 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001965 | 26 | 75 | PF00628 | Zinc finger |
| IPR001965 | 76 | 126 | PF00628 | Zinc finger | |
| IPR001965 | 161 | 223 | PF00628 | Zinc finger | |
| IPR003888 | 619 | 669 | PF05964 | FY-rich | |
| HMMSmart | IPR001965 | 26 | 73 | SM00249 | Zinc finger |
| IPR001965 | 74 | 124 | SM00249 | Zinc finger | |
| IPR001965 | 161 | 221 | SM00249 | Zinc finger | |
| IPR001487 | 229 | 363 | SM00297 | Bromodomain | |
| IPR001965 | 528 | 574 | SM00249 | Zinc finger | |
| IPR003888 | 626 | 669 | SM00541 | FY-rich | |
| ProfileScan | IPR001965 | 24 | 75 | PS50016 | Zinc finger |
| NULL | 27 | 168 | PS50311 | NULL | |
| IPR001965 | 72 | 126 | PS50016 | Zinc finger | |
| IPR001965 | 159 | 223 | PS50016 | Zinc finger | |
| IPR001487 | 299 | 344 | PS50014 | Bromodomain | |
| IPR000694 | 413 | 461 | PS50099 | Proline-rich region | |
| ScanRegExp | IPR001965 | 27 | 94 | PS01359 | Zinc finger |
| IPR000093 | 149 | 171 | PS01300 | RecR protein | |
| IPR001965 | 149 | 220 | PS01359 | Zinc finger |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
