Gene/Protein Characteristic Table for mKIAA1778

Length: 5556 bp

Restriction map

Length of 3'UTR	4870 bp
Genome contig ID	gi65540054r_97419961
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- TATTAAACACTAAAGAATAAAACATTCACTCCTTT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AATTACTCCCCCTGGTTCCTGGGTATGGATTGGCTGGAATATTCTTCTAA

KIAA	Alignment based on:
KIAA1778	DNA sequence, AA sequence, Physical map

Coding region: 3..686

Length: 227 aa

Entry Exp ID% Protein Source BAE43079 9.6e-80 100.0 unnamed protein... Mus musculus Q6WVG3 9.6e-80 100.0 BTB/POZ domain-... Mus musculus EDM02446 1.6e-79 99.6 rCG36961 [Rattu... Rattus norvegicus XP_344451 2e-79 99.6 similar to Pota... Rattus norvegicus XP_001076656 2e-79 99.6 similar to Pota... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220381 4.7e-19 52.9 mKIAA1317

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-