ROUGE |
Gene/Protein Characteristic Table for mKIAA1769 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173259 |
---|---|
H-2 class II histocompatibility antigen, E-B beta chain precursor. | |
mtg00072 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7787 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3715 bp Genome contig ID gi66880554r_180844580 PolyA signal sequence
(TATAAA,-16) +----*----+----*----+----*----+----
TGTAACTGGATAATTTTATTATAAAAATTTCTCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTTCTCATGTCTGTTTTGTGGTATGGGCAGGAGTAGACAGAACTGGC
KIAA Alignment based on: KIAA1769 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 368..4069, 4807..5256, 5686..6048, 6311..6664
Length: 1622 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |