ROUGE

Gene/Protein Characteristic Table for mKIAA1769

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173259
Description :	H-2 class II histocompatibility antigen, E-B beta chain precursor.
Clone Name :	mtg00072 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 7787 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3715 bp

Genome contig ID gi66880554r_180844580
PolyA signal sequence
(TATAAA,-16)
+----*----+----*----+----*----+----
TGTAACTGGATAATTTTATTATAAAAATTTCTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTCTCATGTCTGTTTTGTGGTATGGGCAGGAGTAGACAGAACTGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1769 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1769	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 368..4069, 4807..5256, 5686..6048, 6311..6664
Length: 1622 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL07400	87.6	mCG23072, isofo...	Mus musculus
CAM23416	89.7	novel protein, ...	Mus musculus
NP_898985	87.6	hypothetical pr...	Mus musculus
CAM23414	87.5	novel protein, ...	Mus musculus
EDL07399	93.8	mCG23072, isofo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173310	3.6e-18	24.6	mKIAA1955
BC036177	4.2e-18	28.9	mFLJ00327
AK129259	2.1e-12	30.8	mKIAA1008
AB093209	3.2e-06	28.3	mKIAA0054
AK129051	2.9e-05	26.5	mKIAA0083

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001900 464 684 PF00773 Ribonuclease II

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001900	464	684	PF00773	Ribonuclease II

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3715 bp
Genome contig ID	gi66880554r_180844580
PolyA signal sequence (TATAAA,-16)	+--------+--------+----*----+---- TGTAACTGGATAATTTTATTATAAAAATTTCTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTCTCATGTCTGTTTTGTGGTATGGGCAGGAGTAGACAGAACTGGC

Gene/Protein Characteristic Table for mKIAA1769

Features of the cloned DNA sequence

Features of the protein sequence