ROUGE

Gene/Protein Characteristic Table for mFLJ00327

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC036177
Description :
Clone Name :	mid41093 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3113 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 351 bp

Genome contig ID gi65488608f_86420104
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ATCAGTGTCATGGAATAAAATCAAGTGTGAATTGC
Flanking genome sequence
(446154 - 446203)
----+----*----+----*----+----*----+----*----+----*
TGTCTGTGTAGATGCCATGGGCAAGCATGGCAGCTGGGTGGCCTGTCACC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00327 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00327	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 117..2762
Length: 881 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8CI75	100.0	DIS3-like exonu...	Mus musculus
EDL75609	95.3	similar to RIKE...	Rattus norvegicus
EAW70988	86.3	hCG2013107, iso...	Homo sapiens
Q8IYB7	86.2	DIS3-like exonu...	Homo sapiens
XP_597436	85.8	similar to DIS3...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173310	2.9e-53	30.1	mKIAA1955
AK129259	2.5e-27	31.4	mKIAA1008
AK173259	1.9e-17	28.7	mKIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 82 143 PF08206 NULL

IPR001900 381 619 PF00773 Ribonuclease II

ScanRegExp IPR001900 697 721 PS01175 Ribonuclease II

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	82	143	PF08206	NULL
IPR001900	381	619	PF00773	Ribonuclease II
ScanRegExp	IPR001900	697	721	PS01175	Ribonuclease II

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	351 bp
Genome contig ID	gi65488608f_86420104
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATCAGTGTCATGGAATAAAATCAAGTGTGAATTGC
Flanking genome sequence (446154 - 446203)	----+--------+--------+--------+--------+----* TGTCTGTGTAGATGCCATGGGCAAGCATGGCAGCTGGGTGGCCTGTCACC

Gene/Protein Characteristic Table for mFLJ00327

Features of the cloned DNA sequence

Features of the protein sequence