ROUGE

Gene/Protein Characteristic Table for mKIAA1764

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173256
Description :
Clone Name :	mpm02096 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5601 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2446 bp

Genome contig ID gi65492966f_14430713
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTTTTCTTATAATAAACTTACATTTCTTATGTTTC
Flanking genome sequence
(134443 - 134492)
----+----*----+----*----+----*----+----*----+----*
AATATGCATCATTTCTATGTACGAATACGATTTAAGGCTTCATTTATCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1764 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1764	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 51..3155
Length: 1034 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q69ZB0	100.0	Leucine-rich re...	Mus musculus
EDL05142	99.8	leucine rich re...	Mus musculus
EDL05143	99.8	leucine rich re...	Mus musculus
BAB23437	99.7	unnamed protein...	Mus musculus
XP_342210	88.3	similar to leuc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173045	1.6e-05	24.0	mKIAA0866
AK131171	3.5e-05	22.1	mFLJ00279
AK173096	0.00011	21.9	mKIAA1074
AB093232	0.001	21.5	mKIAA0336

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 70 83 PR00019 Leucine-rich repeat

IPR001611 111 124 PR00019 Leucine-rich repeat

HMMPfam IPR001611 69 90 PF00560 Leucine-rich repeat

IPR001611 91 112 PF00560 Leucine-rich repeat

IPR001611 113 134 PF00560 Leucine-rich repeat

IPR001611 139 160 PF00560 Leucine-rich repeat

HMMSmart IPR003885 67 88 SM00365 Leucine-rich repeat

IPR003885 89 110 SM00365 Leucine-rich repeat

IPR003885 111 132 SM00365 Leucine-rich repeat

ProfileScan IPR007092 54 119 PS50504 Leucine-rich repeat

IPR002017 870 989 PS50083 Spectrin repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	70	83	PR00019	Leucine-rich repeat
IPR001611	111	124	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	69	90	PF00560	Leucine-rich repeat
IPR001611	91	112	PF00560	Leucine-rich repeat
IPR001611	113	134	PF00560	Leucine-rich repeat
IPR001611	139	160	PF00560	Leucine-rich repeat
HMMSmart	IPR003885	67	88	SM00365	Leucine-rich repeat
IPR003885	89	110	SM00365	Leucine-rich repeat
IPR003885	111	132	SM00365	Leucine-rich repeat
ProfileScan	IPR007092	54	119	PS50504	Leucine-rich repeat
IPR002017	870	989	PS50083	Spectrin repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2446 bp
Genome contig ID	gi65492966f_14430713
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTTTTCTTATAATAAACTTACATTTCTTATGTTTC
Flanking genome sequence (134443 - 134492)	----+--------+--------+--------+--------+----* AATATGCATCATTTCTATGTACGAATACGATTTAAGGCTTCATTTATCAA

Gene/Protein Characteristic Table for mKIAA1764

Features of the cloned DNA sequence

Features of the protein sequence