ROUGE

Gene/Protein Characteristic Table for mKIAA1756

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122550
Description :	Enaptin165 short isoform.
Clone Name :	mbg13770 [Vector Info]
Source :	Mouse brain
Note :	We replaced mbg07472a, former representative clones for mKIAA1756 with mbg13770. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 5412 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2254 bp

Genome contig ID gi65524842f_5041638
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TTGTGTGCAATATCATTAAACTATTTTTATGGTTG
Flanking genome sequence
(132075 - 132124)
----+----*----+----*----+----*----+----*----+----*
CATTATTCTTTTCCTTGATTTTGGTTTGATGCCCATGTAGTGCCCTGGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1756 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1756	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 183..3158
Length: 991 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL03571	100.0	mCG141368, isof...	Mus musculus
AAN03487	99.8	enaptin165 shor...	Mus musculus
BAC27900	100.0	unnamed protein...	Mus musculus
EDL92843	92.5	rCG41158, isofo...	Rattus norvegicus
NP_001025080	92.5	spectrin repeat...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220188	3.6e-06	21.0	mKIAA4151
AK131171	0.00032	20.4	mFLJ00279
AK220172	0.00035	22.0	mKIAA4046

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR002017 137 210 PS50083 Spectrin repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002017	137	210	PS50083	Spectrin repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2254 bp
Genome contig ID	gi65524842f_5041638
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTGTGTGCAATATCATTAAACTATTTTTATGGTTG
Flanking genome sequence (132075 - 132124)	----+--------+--------+--------+--------+----* CATTATTCTTTTCCTTGATTTTGGTTTGATGCCCATGTAGTGCCCTGGTT

Gene/Protein Characteristic Table for mKIAA1756

Features of the cloned DNA sequence

Features of the protein sequence