ROUGE |
Gene/Protein Characteristic Table for mKIAA4151 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220188 |
---|---|
mpf01376 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6874 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1122 bp Genome contig ID gi65546577f_35631661 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TAACTACTGTAAAATAATAAAATTATTTTCAGAATFlanking genome sequence
(119019 - 119068) ----+----*----+----*----+----*----+----*----+----*
AAGGAATTGTGTGAGACTATCTGTTGGCACAGAAGTTACATGCCTGTGTT
Features of the protein sequence |
Description | |
Coding region: 2..5749
Length: 1916 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | NULL | 248 | 658 | PS50313 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 1892 | 1914 | RVPLLAAIYFLMIHVLLVLCFTG |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |