ROUGE

Gene/Protein Characteristic Table for mKIAA1682

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122539
Description :	phosphatidylinositol-3-phosphatase associated protein. phosphatidylinositol-3 phosphate 3-phosphatase adaptor subunit.
Clone Name :	mbh02812 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4312 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1905 bp

Genome contig ID gi65543215f_11916871
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TGTGGATTATGCTTAACATTAAAAGATACAATAAG
Flanking genome sequence
(166731 - 166780)
----+----*----+----*----+----*----+----*----+----*
ACCATTTGTTTAAAACACACTGTGCAAGTTTGGAAGTGTCTGTTAATAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1682 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1682	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2407
Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q80TA6	100.0	Myotubularin-re...	Mus musculus
EDL03270	100.0	Vmyotubularin r...	Mus musculus
Q5FVM6	94.4	Myotubularin-re...	Rattus norvegicus
XP_001089010	88.6	similar to phos...	Macaca mulatta
Q9C0I1	89.4	Myotubularin-re...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220524	6.3e-14	36.1	mKIAA4176
AK220369	4.6e-12	36.0	mKIAA1073
AF262986	1.5e-11	25.8	mKIAA0647
AK129485	1.7e-09	27.4	mKIAA3020

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010569 287 351 PF06602 Myotubularin-related

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010569	287	351	PF06602	Myotubularin-related

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1905 bp
Genome contig ID	gi65543215f_11916871
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TGTGGATTATGCTTAACATTAAAAGATACAATAAG
Flanking genome sequence (166731 - 166780)	----+--------+--------+--------+--------+----* ACCATTTGTTTAAAACACACTGTGCAAGTTTGGAAGTGTCTGTTAATAAT

Gene/Protein Characteristic Table for mKIAA1682

Features of the cloned DNA sequence

Features of the protein sequence