ROUGE

Gene/Protein Characteristic Table for mKIAA1665

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC010793
Description :	DNA-directed RNA polymerase III subunit 22.9 kDa polypeptide.
Clone Name :	mie39080 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 877 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 528 bp

Genome contig ID gi65543215r_81866802
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CGCAGAATACATTTAATAAATACTGGTGGCAGAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGAACCTCCCCTTTTCATTAGCTGACATCACCATCTAAGGTCACTGAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1665 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1665	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..349
Length: 115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL04547	1.4e-48	100.0	polymerase (RNA...	Mus musculus
EDM15696	1.8e-48	100.0	polymerase (RNA...	Rattus norvegicus
Q9D2C6	1.8e-48	100.0	DNA-directed RN...	Mus musculus
BAE31279	8.2e-48	99.1	unnamed protein...	Mus musculus
XP_849136	1.2e-47	98.3	similar to poly...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]
Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 1 112 PF08292 NULL
Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	1	112	PF08292	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	528 bp
Genome contig ID	gi65543215r_81866802
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CGCAGAATACATTTAATAAATACTGGTGGCAGAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGAACCTCCCCTTTTCATTAGCTGACATCACCATCTAAGGTCACTGAAT

Gene/Protein Characteristic Table for mKIAA1665

Features of the cloned DNA sequence

Features of the protein sequence