ROUGE

Gene/Protein Characteristic Table for mKIAA1610

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129405
Description :
Clone Name :	mpm01218 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4757 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3002 bp

Genome contig ID gi65493515f_101974466
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CATTCTGATATGCTCATTAAAATATTTTTGTAAAC
Flanking genome sequence
(150193 - 150242)
----+----*----+----*----+----*----+----*----+----*
ATACTTGTGTGGTGTCTAGTTATTTCACTGTTTTAATTTCAGTGTTTAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1610 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1610	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 91..1755
Length: 554 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAV37181	7.8e-184	100.0	mesoderm induct...	Mus musculus
EDL97866	6.2e-178	97.0	similar to meso...	Rattus norvegicus
CAI18875	2.3e-176	95.1	mesoderm induct...	Homo sapiens
AAV37183	1.6e-175	99.8	mesoderm induct...	Mus musculus
AAV37182	1.9e-175	100.0	mesoderm induct...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173128	3.8e-28	45.0	mKIAA1193

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000949 222 289 PF01448 ELM2

IPR001005 327 373 PF00249 Myb

HMMSmart NULL 326 375 SM00395 NULL

ProfileScan NULL 79 339 PS50313 NULL

ScanRegExp IPR002048 75 87 PS00018 Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	222	289	PF01448	ELM2
IPR001005	327	373	PF00249	Myb
HMMSmart	NULL	326	375	SM00395	NULL
ProfileScan	NULL	79	339	PS50313	NULL
ScanRegExp	IPR002048	75	87	PS00018	Calcium-binding EF-hand

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3002 bp
Genome contig ID	gi65493515f_101974466
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CATTCTGATATGCTCATTAAAATATTTTTGTAAAC
Flanking genome sequence (150193 - 150242)	----+--------+--------+--------+--------+----* ATACTTGTGTGGTGTCTAGTTATTTCACTGTTTTAATTTCAGTGTTTAAA

Gene/Protein Characteristic Table for mKIAA1610

Features of the cloned DNA sequence

Features of the protein sequence