ROUGE

Gene/Protein Characteristic Table for mKIAA1193

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173128
Description :
Clone Name :	mej02325 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2716 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1366 bp

Genome contig ID gi65524842r_79560965
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
AATGCTATTTTATTTATTAAACTTGATTTGAAGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGGGGTGTCTCATGGATTCCAGGGGCTCTCCCTTGGGGACTTGGGCATGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1193 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1193	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 187..1326, 1350..1784
Length: 524 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH67013	8.8e-170	95.3	Mesoderm induct...	Mus musculus
Q3U3N0	4.9e-169	94.9	Mesoderm induct...	Mus musculus
EDL31690	3.5e-137	93.6	mesoderm induct...	Mus musculus
EDL31693	7.7e-121	93.3	mesoderm induct...	Mus musculus
EDL31692	1.8e-119	88.4	mesoderm induct...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129405	7e-26	45.0	mKIAA1610

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000949 185 246 PF01448 ELM2

IPR001005 289 335 PF00249 Myb

HMMSmart NULL 288 337 SM00395 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	185	246	PF01448	ELM2
IPR001005	289	335	PF00249	Myb
HMMSmart	NULL	288	337	SM00395	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1366 bp
Genome contig ID	gi65524842r_79560965
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AATGCTATTTTATTTATTAAACTTGATTTGAAGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CGGGGTGTCTCATGGATTCCAGGGGCTCTCCCTTGGGGACTTGGGCATGA

Gene/Protein Characteristic Table for mKIAA1193

Features of the cloned DNA sequence

Features of the protein sequence