ROUGE

Gene/Protein Characteristic Table for mKIAA1577

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122528
Description :	Zinc finger SWIM domain containing protein 6 (Fragment).
Clone Name :	mbh02526 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4218 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1734 bp

Genome contig ID gi65535943r_103850402
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTTTTGTTTTGATTAAAATTAGTTTTTTGAAAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GATTCTGCCTCGTTTATATCTACCTTGTGATACTTGAATTGTGTGTTCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1577 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1577	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2484
Length: 827 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC29905	3.8e-195	91.8	unnamed protein...	Mus musculus
EDL18460	4.8e-195	94.2	mCG10236 [Mus m...	Mus musculus
Q80TB7	4.9e-195	94.4	Zinc finger SWI...	Mus musculus
NP_663431	5.6e-195	94.4	zinc finger, SW...	Mus musculus
AAP92586	1.5e-193	90.7	Ab2-064 [Rattus...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122519	6.7e-122	71.0	mKIAA1511
AK131119	4.4e-114	52.8	mFLJ00044

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007527 48 85 PF04434 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007527	48	85	PF04434	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1734 bp
Genome contig ID	gi65535943r_103850402
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTTTTGTTTTGATTAAAATTAGTTTTTTGAAAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GATTCTGCCTCGTTTATATCTACCTTGTGATACTTGAATTGTGTGTTCAG

Gene/Protein Characteristic Table for mKIAA1577

Features of the cloned DNA sequence

Features of the protein sequence