ROUGE |
Gene/Protein Characteristic Table for mKIAA1511 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122519 |
---|---|
Zinc finger SWIM domain containing protein 5. | |
mbg03448 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5401 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1776 bp Genome contig ID gi65493515f_115736308 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GCTGTTCGTGGCTACTAATAAATGTGTTACTGTCCFlanking genome sequence
(211705 - 211754) ----+----*----+----*----+----*----+----*----+----*
AGCCAAGGGCCCCTACACTGTCTCAGCCCAATGGGTTGGCAAAAAAAGGA
KIAA Alignment based on: KIAA1511 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..3625
Length: 1207 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |