ROUGE

Gene/Protein Characteristic Table for mKIAA1511

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122519
Description :	Zinc finger SWIM domain containing protein 5.
Clone Name :	mbg03448 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5401 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1776 bp

Genome contig ID gi65493515f_115736308
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GCTGTTCGTGGCTACTAATAAATGTGTTACTGTCC
Flanking genome sequence
(211705 - 211754)
----+----*----+----*----+----*----+----*----+----*
AGCCAAGGGCCCCTACACTGTCTCAGCCCAATGGGTTGGCAAAAAAAGGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1511 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1511	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3625
Length: 1207 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q80TC6	100.0	Zinc finger SWI...	Mus musculus
XP_513126	96.0	zinc finger, SW...	Pan troglodytes
Q9P217	95.8	Zinc finger SWI...	Homo sapiens
EDL30577	99.2	zinc finger, SW...	Mus musculus
XP_853236	90.1	similar to Zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131119	1.9e-115	65.6	mFLJ00044
AK122528	1.4e-69	70.8	mKIAA1577

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007527 241 278 PF04434 Zinc finger

ProfileScan NULL 138 199 PS50315 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007527	241	278	PF04434	Zinc finger
ProfileScan	NULL	138	199	PS50315	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1776 bp
Genome contig ID	gi65493515f_115736308
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCTGTTCGTGGCTACTAATAAATGTGTTACTGTCC
Flanking genome sequence (211705 - 211754)	----+--------+--------+--------+--------+----* AGCCAAGGGCCCCTACACTGTCTCAGCCCAATGGGTTGGCAAAAAAAGGA

Gene/Protein Characteristic Table for mKIAA1511

Features of the cloned DNA sequence

Features of the protein sequence