ROUGE

Gene/Protein Characteristic Table for mFLJ00044

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131119
Description :	Zinc finger SWIM domain containing protein 4.
Clone Name :	mph00426 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3186 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 984 bp

Genome contig ID gi65515060r_83374073
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTTTTCCTTTTTTTTAAAAAAAAGATTGAACAC
Flanking genome sequence
(99956 - 99907)
----+----*----+----*----+----*----+----*----+----*
AACTTCTTTTTAACTTCAAGACTGGGTTGCATTGCTAACACAAACACCCG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00044 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00044	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2202
Length: 733 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21369	100.0	mFLJ00044 prote...	Mus musculus
EDL10938	100.0	zinc finger, SW...	Mus musculus
Q8C7B8	99.9	Zinc finger SWI...	Mus musculus
BAC35466	99.9	unnamed protein...	Mus musculus
BAC34867	99.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122519	1.1e-199	65.6	mKIAA1511
AK122528	2.1e-113	52.8	mKIAA1577

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	984 bp
Genome contig ID	gi65515060r_83374073
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTTTTCCTTTTTTTTAAAAAAAAGATTGAACAC
Flanking genome sequence (99956 - 99907)	----+--------+--------+--------+--------+----* AACTTCTTTTTAACTTCAAGACTGGGTTGCATTGCTAACACAAACACCCG

Gene/Protein Characteristic Table for mFLJ00044

Features of the cloned DNA sequence

Features of the protein sequence