ROUGE

Gene/Protein Characteristic Table for mKIAA1568

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129396
Description :	Roundabout homolog 2 precursor.
Clone Name :	mbg15046 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5898 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3518 bp

Genome contig ID gi65546577r_72873943
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTTTTACTCTCATAACATTAAAAGCATTTGTTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTCAAGTGTTACAAGATAGATTTTTGTGGTCGTGGGTAGACGTTTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1568 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1568	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2380
Length: 792 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7TPD3	0	100.0	Roundabout homo...	Mus musculus
XP_001064680	0	97.7	similar to Roun...	Rattus norvegicus
XP_213677	0	97.7	similar to Roun...	Rattus norvegicus
XP_001144336	0	93.6	similar to Roun...	Pan troglodytes
XP_614756	8.1e-211	83.4	roundabout, axo...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK004723	2.7e-08	25.3	mFLJ00236

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR003962 80 89 PR00014 Fibronectin

IPR003962 118 136 PR00014 Fibronectin

IPR003962 136 150 PR00014 Fibronectin

HMMPfam IPR003961 62 152 PF00041 Fibronectin

HMMSmart IPR003961 62 149 SM00060 Fibronectin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003962	80	89	PR00014	Fibronectin
IPR003962	118	136	PR00014	Fibronectin
IPR003962	136	150	PR00014	Fibronectin
HMMPfam	IPR003961	62	152	PF00041	Fibronectin
HMMSmart	IPR003961	62	149	SM00060	Fibronectin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3518 bp
Genome contig ID	gi65546577r_72873943
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTTTACTCTCATAACATTAAAAGCATTTGTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTCAAGTGTTACAAGATAGATTTTTGTGGTCGTGGGTAGACGTTTTA

Gene/Protein Characteristic Table for mKIAA1568

Features of the cloned DNA sequence

Features of the protein sequence