Gene/Protein Characteristic Table for mFLJ00236

Length: 2741 bp

Restriction map

Length of 3'UTR	635 bp
Genome contig ID	gi65519420f_37245935
PolyA signal sequence (TATAAA,-18)	+----*----+----*----+----*----+---- CTTAAGGAACTTAATTCTATAAAACTGTAAAGACG
Flanking genome sequence (109629 - 109678)	----+----*----+----*----+----*----+----*----+----* AGTTCTGTGACATCATTCCTTGGGCTCTATTTTGGGAAGGGTACCTGCAG

KIAA	Alignment based on:
FLJ00236	DNA sequence, AA sequence, Physical map

Coding region: 1..2106

Length: 701 aa

Entry Exp ID% Protein Source BAB23506 0 100.0 unnamed protein... Mus musculus EDL25428 0 100.0 roundabout homo... Mus musculus AAH71193 0 99.0 Robo4 protein [... Mus musculus Q8C310 0 99.0 Roundabout homo... Mus musculus EDL25427 0 99.0 roundabout homo... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129396 3.2e-08 25.6 mKIAA1568

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003962	58	67	PR00014	Fibronectin
	IPR003962	73	83	PR00014	Fibronectin
	IPR003962	113	127	PR00014	Fibronectin
HMMPfam	IPR003961	44	129	PF00041	Fibronectin
HMMSmart	IPR003961	44	126	SM00060	Fibronectin
ProfileScan	NULL	448	480	PS50324	NULL
ScanRegExp	IPR005829	120	145	PS00217	Sugar transporter superfamily

Method	From	To	amino acid sequence
SOSUI	166	187	EVIASSAVLLWLLLLGITVCIY