ROUGE

Gene/Protein Characteristic Table for mKIAA1513

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122520
Description :	Pogo transposable element with KRAB domain.
Clone Name :	mbg06025 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3827 bp

Genome contig ID gi65488608r_166216651
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
GATAGAAACTGATCCCAGTAATAAACTTTGATAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGACAATAGGCTCTGGTGATTTTATTTATTGCTGGTGTTATCCAAAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1513 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1513	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 355..2220
Length: 621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC33234	100.0	unnamed protein...	Mus musculus
BAC35580	99.8	unnamed protein...	Mus musculus
NP_001136420	98.7	pogo transposab...	Mus musculus
Q80TC5	100.0	Pogo transposab...	Mus musculus
AAH72587	98.5	Pogk protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122288	1e-13	24.4	mKIAA0461
AK129160	3.2e-08	45.8	mKIAA0543
AK220563	3.3e-05	22.4	mKIAA4237
AK032286	0.00013	36.5	mKIAA1954
AK220194	0.00017	33.3	mKIAA4218

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001909 61 101 PF01352 KRAB box

IPR004875 369 581 PF03184 CENP-B protein

HMMSmart IPR001909 61 121 SM00349 KRAB box

ProfileScan IPR003655 58 122 PS50806 KRAB-related

IPR001909 61 132 PS50805 KRAB box

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	61	101	PF01352	KRAB box
IPR004875	369	581	PF03184	CENP-B protein
HMMSmart	IPR001909	61	121	SM00349	KRAB box
ProfileScan	IPR003655	58	122	PS50806	KRAB-related
IPR001909	61	132	PS50805	KRAB box

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3827 bp
Genome contig ID	gi65488608r_166216651
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GATAGAAACTGATCCCAGTAATAAACTTTGATAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGACAATAGGCTCTGGTGATTTTATTTATTGCTGGTGTTATCCAAAGT

Gene/Protein Characteristic Table for mKIAA1513

Features of the cloned DNA sequence

Features of the protein sequence