ROUGE |
Gene/Protein Characteristic Table for mKIAA4218 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220194 |
---|---|
zinc finger protein 354C. transcription factor 17-like 2. |
|
mpm12334 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5333 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3477 bp Genome contig ID gi65527427r_50463928 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TATGTTTAAATGTAATAAAAATTGAGGCAAAAATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTATAAAGTGGTGAATGTGAGCTTTTTGTTTCAGGCTTAGAGAAACTG
Features of the protein sequence |
Description | |
Coding region: 51..1853
Length: 601 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |