ROUGE |
Gene/Protein Characteristic Table for mKIAA1954 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK032286 |
---|---|
Zinc finger protein 90. | |
mpj01436 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2574 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 303 bp Genome contig ID gi65515060f_105611226 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGCTTGATATGTAAATCCTGTTGTTCACAACCTTGFlanking genome sequence
(110494 - 110543) ----+----*----+----*----+----*----+----*----+----*
AAAGAAAGAAAGAAAACTCATAGTATGGCCAAGGCTCATTTCAAACATCA
KIAA Alignment based on: KIAA1954 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 340..2271
Length: 643 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |