ROUGE |
Gene/Protein Characteristic Table for mKIAA1475 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173179 |
---|---|
Vacuolar protein sorting 18. | |
msh04351 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3117 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 751 bp Genome contig ID gi66880554f_118707000 PolyA signal sequence
(AATAAA,-9) +----*----+----*----+----*----+----
AAAAAAAAATTAAATTAAATTAAAAAAATAAAAATFlanking genome sequence
(105193 - 105242) ----+----*----+----*----+----*----+----*----+----*
AAAAAGAAGAAGTCCAGAGTCCTGCAAGCCTTTGAGCCTTGGCGTAGGTC
KIAA Alignment based on: KIAA1475 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2366
Length: 787 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |