KIAA1475

Product ID	ORK02035
Accession No	AB040908
Description	vacuolar protein sorting 18 homolog (S. cerevisiae)
Clone name	fj03454
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fj03454 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGT CGCCCACGCG TCCGCCCACG CGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (3869 bp) Predicted protein sequence (986 aa)
HaloTag ORF Clone	FHC02035
Flexi ORF Clone	FXC02035
Source	Human fetal brain
Rouge ID	mKIAA1475 by Kazusa Mouse cDNA Project

Length: 3869 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	633 bp
Genome contig ID	gi51511731f_38873945
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GATGGAGGTGGAGAGCATTAAACTGTCTGCACTGC
Flanking genome sequence (109521 - 109570)	----+--------+--------+--------+--------+----* ACTGGTGGCTTTGTGTCGATGCTGGGCCGAGCGGTGTGTGAGTGATCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	38973945	38983464	5	100.0	Perfect prediction

Length: 986 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P253	100.0	Vacuolar protei...	Homo sapiens
XP_523187	99.7	vacuolar protei...	Pan troglodytes
XP_001099146	99.7	similar to vacu...	Macaca mulatta
XP_544627	97.4	similar to vacu...	Canis lupus fam...
XP_001503547	97.5	similar to LOC5...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007810	304	449	PF05131	Pep3/Vps18/deep orange

Primer_f	TCTTCCGTCTGTTCACTCTGC
Primer_r	TCACCCAATGCCCAGGACTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-