ROUGE |
Gene/Protein Characteristic Table for mKIAA1439 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173173 |
---|---|
Nuclear factor 1 A-type. | |
mbg18603 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6197 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4875 bp Genome contig ID gi65493515f_96658154 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
AAGGAAAAATAAAAAAAAAATTGCTAATGCTACGGFlanking genome sequence
(435796 - 435845) ----+----*----+----*----+----*----+----*----+----*
AAGCCGTGTCCTCTTTTGCTGTGTACACAATGCCTGGGGTGAGTGAGCTG
KIAA Alignment based on: KIAA1439 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1322
Length: 439 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |