Gene/Protein Characteristic Table for mKIAA0411

Length: 7165 bp

Restriction map

Length of 3'UTR	4800 bp
Genome contig ID	gi65504368r_113181335
PolyA signal sequence (AATAAA,-24)	+----*----+----*----+----*----+---- CTATCCTGTGAAATAAAACAGCTTAACTTTTTCTC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAACATAGTCTGTGGTTGTTTACAAGCATAAGGACACACCCAGGGGAGTG

KIAA	Alignment based on:
KIAA0411	DNA sequence, AA sequence, Physical map

Coding region: 317..2365

Length: 682 aa

Entry Exp ID% Protein Source XP_590495 0 99.1 similar to SLIT... Bos taurus AAN57784 0 98.9 WAVE-associated... Homo sapiens XP_001495819 0 98.6 SLIT-ROBO Rho G... Equus caballus XP_001097317 0 97.5 similar to SLIT... Macaca mulatta EAW63950 1.2e-195 98.7 SLIT-ROBO Rho G... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129060 3.6e-26 47.4 mKIAA0131 AK122508 2.1e-11 32.2 mKIAA1424 AK173187 4.1e-11 31.5 mKIAA1501 AK173242 1.2e-09 33.8 mKIAA1722 AK129482 7.4e-09 31.5 mKIAA3017

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001060	56	154	PF00611	Cdc15/Fes/CIP4
	IPR000198	530	682	PF00620	RhoGAP
HMMSmart	IPR001060	56	154	SM00055	Cdc15/Fes/CIP4
	IPR000198	527	682	SM00324	RhoGAP
ProfileScan	IPR001060	56	121	PS50133	Cdc15/Fes/CIP4
	IPR000198	530	675	PS50238	RhoGAP

Method	From	To	amino acid sequence
-	-	-	-