ROUGE |
Gene/Protein Characteristic Table for mKIAA0621 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129176 |
---|---|
GRAF protein (Fragment). | |
mbf03424 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7786 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 5072 bp Genome contig ID gi65551972f_39116930 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
AGTATGATTTTTGAATTAAATGACTTTCCCATTTGFlanking genome sequence
(483155 - 483204) ----+----*----+----*----+----*----+----*----+----*
ATGGTGTGTTTGTTTCTTGGGTTTCTGGTTAGTTTTGACTCAACTTATTT
KIAA Alignment based on: KIAA0621 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 171..2714
Length: 847 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |