ROUGE

Gene/Protein Characteristic Table for mKIAA1417

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129353
Description :	Similar to DJ93K22.1.
Clone Name :	mpm10268 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4527 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1022 bp

Genome contig ID gi65519420r_85918013
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAGCAGCAGACGTGCAATAAAAGTAAAGTCAATCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTCCTCTAGCGTGTGTTTGATTTCATGTGTAGCACTAGACACCTGGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1417 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1417	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3505
Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZPR6	92.0	Inhibitor of Br...	Mus musculus
EDL26483	92.0	mCG128548, isof...	Mus musculus
EDL77645	86.6	rCG25208, isofo...	Rattus norvegicus
XP_001062352	86.5	similar to inhi...	Rattus norvegicus
Q9P2D0	78.7	Inhibitor of Br...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 2 14 PR01415 Ankyrin

IPR002110 14 26 PR01415 Ankyrin

HMMPfam IPR002110 1 33 PF00023 Ankyrin

IPR000408 62 114 PF00415 Regulator of chromosome condensation

IPR000210 370 484 PF00651 BTB/POZ

IPR000210 573 687 PF00651 BTB/POZ

HMMSmart IPR002110 1 30 SM00248 Ankyrin

IPR000210 380 560 SM00225 BTB/POZ

IPR000210 584 687 SM00225 BTB/POZ

ProfileScan IPR002110 1 33 PS50088 Ankyrin

IPR002110 1 41 PS50297 Ankyrin

IPR000408 63 117 PS50012 Regulator of chromosome condensation

IPR000210 380 460 PS50097 BTB/POZ

IPR000210 584 652 PS50097 BTB/POZ

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	2	14	PR01415	Ankyrin
IPR002110	14	26	PR01415	Ankyrin
HMMPfam	IPR002110	1	33	PF00023	Ankyrin
IPR000408	62	114	PF00415	Regulator of chromosome condensation
IPR000210	370	484	PF00651	BTB/POZ
IPR000210	573	687	PF00651	BTB/POZ
HMMSmart	IPR002110	1	30	SM00248	Ankyrin
IPR000210	380	560	SM00225	BTB/POZ
IPR000210	584	687	SM00225	BTB/POZ
ProfileScan	IPR002110	1	33	PS50088	Ankyrin
IPR002110	1	41	PS50297	Ankyrin
IPR000408	63	117	PS50012	Regulator of chromosome condensation
IPR000210	380	460	PS50097	BTB/POZ
IPR000210	584	652	PS50097	BTB/POZ

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1022 bp
Genome contig ID	gi65519420r_85918013
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAGCAGCAGACGTGCAATAAAAGTAAAGTCAATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTCCTCTAGCGTGTGTTTGATTTCATGTGTAGCACTAGACACCTGGAG

Gene/Protein Characteristic Table for mKIAA1417

Features of the cloned DNA sequence

Features of the protein sequence