ROUGE

Gene/Protein Characteristic Table for mKIAA1379

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC014698
Description :	Protein kinase C and casein kinase substrate in neurons protein 1.
Clone Name :	mbk00444 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1305 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 127 bp

Genome contig ID gi65550231f_25398713
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCAAGCTTTTATTTTTTTAAAAGTCAAAACAGAAC
Flanking genome sequence
(105870 - 105919)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAAGAAATACGAAGAGACAGCGTTTGCAGCCTACC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1379 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1379	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1178
Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q61644	9.3e-142	100.0	Protein kinase ...	Mus musculus
EDL22546	1.6e-141	99.7	protein kinase ...	Mus musculus
BAE34611	1.8e-141	99.7	unnamed protein...	Mus musculus
Q9Z0W5	2.1e-140	98.7	Protein kinase ...	Rattus norvegicus
XP_850083	1.7e-137	95.9	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 337 389 PD000066 SH3

FPrintScan IPR001452 335 345 PR00452 SH3

IPR001452 349 364 PR00452 SH3

IPR001452 379 391 PR00452 SH3

HMMPfam IPR001452 335 391 PF00018 SH3

IPR011511 336 391 PF07653 Variant SH3

HMMSmart IPR001452 335 391 SM00326 SH3

ProfileScan IPR001452 332 391 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	337	389	PD000066	SH3
FPrintScan	IPR001452	335	345	PR00452	SH3
IPR001452	349	364	PR00452	SH3
IPR001452	379	391	PR00452	SH3
HMMPfam	IPR001452	335	391	PF00018	SH3
IPR011511	336	391	PF07653	Variant SH3
HMMSmart	IPR001452	335	391	SM00326	SH3
ProfileScan	IPR001452	332	391	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	127 bp
Genome contig ID	gi65550231f_25398713
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAAGCTTTTATTTTTTTAAAAGTCAAAACAGAAC
Flanking genome sequence (105870 - 105919)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAGAAATACGAAGAGACAGCGTTTGCAGCCTACC

Gene/Protein Characteristic Table for mKIAA1379

Features of the cloned DNA sequence

Features of the protein sequence