ROUGE

Gene/Protein Characteristic Table for mKIAA1378

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK031028
Description :	Kelch-like protein 8.
Clone Name :	mek00908 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 611 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 292 bp

Genome contig ID gi65498774r_102797568
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GCTCTTTATTTTGATGAATAAAATGTAATTTATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTTCATCTATTCTTTTTCCTGAAGAAACTAACTTCAGGCAGTAGGTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1378 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1378	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..319
Length: 105 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM21395	1.2e-44	100.0	kelch-like 8 (D...	Mus musculus
CAM21396	1.5e-44	100.0	kelch-like 8 (D...	Mus musculus
EDL99514	1.6e-44	100.0	rCG37870, isofo...	Rattus norvegicus
BAC27220	1.6e-44	100.0	unnamed protein...	Mus musculus
P59280	1.6e-44	100.0	Kelch-like prot...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220547	1e-16	51.8	mKIAA4210
AK220397	8e-16	39.4	mKIAA1490
AK220195	2.7e-15	40.4	mKIAA4221
AK129061	2.4e-12	38.8	mKIAA0132
AK173029	8.3e-12	38.6	mKIAA0795

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006651 38 51 PR00501 Kelch motif

IPR006651 55 69 PR00501 Kelch motif

HMMPfam IPR011498 28 73 PF07646 Kelch

IPR006652 28 73 PF01344 Kelch repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	38	51	PR00501	Kelch motif
IPR006651	55	69	PR00501	Kelch motif
HMMPfam	IPR011498	28	73	PF07646	Kelch
IPR006652	28	73	PF01344	Kelch repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	292 bp
Genome contig ID	gi65498774r_102797568
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCTCTTTATTTTGATGAATAAAATGTAATTTATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTCATCTATTCTTTTTCCTGAAGAAACTAACTTCAGGCAGTAGGTTT

Gene/Protein Characteristic Table for mKIAA1378

Features of the cloned DNA sequence

Features of the protein sequence