KIAA1362

Product ID	ORK05017
Accession No	AB037783
Description	FYVE, RhoGEF and PH domain containing 6
Clone name	fj02381
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3842 bp) Predicted protein sequence (699 aa)
Source	Human fetal brain
Rouge ID	mKIAA1362 by Kazusa Mouse cDNA Project

Length: 3842 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1741 bp
Genome contig ID	gi89161190r_93898158
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGATGACAGAGCGAGACTCCATCTC
Flanking genome sequence (99718 - 99669)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATTGAACAGCAAGGTTATCCATATAATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	93997876	94127187	20	99.5	Perfect prediction

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC87464	99.9	unnamed protein...	Homo sapiens
Q6ZV73	99.9	FYVE, RhoGEF an...	Homo sapiens
BAC85990	99.7	unnamed protein...	Homo sapiens
XP_509275	99.3	FYVE, RhoGEF an...	Pan troglodytes
XP_001142099	99.3	FYVE, RhoGEF an...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018336	3.6e-21	28.2	KIAA0793
AB002335	9.1e-11	26.0	KIAA0337
AB002303	7e-09	30.6	KIAA0305
AB002292	9.3e-08	25.8	KIAA0294
AB037836	1.4e-07	25.4	KIAA1415

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	207	391	PF00621	DH
	IPR001849	422	515	PF00169	Pleckstrin-like
	IPR000306	549	614	PF01363	Zinc finger
HMMSmart	IPR000219	207	391	SM00325	DH
	IPR001849	422	517	SM00233	Pleckstrin-like
	IPR000306	546	614	SM00064	Zinc finger
ProfileScan	IPR000219	203	392	PS50010	DH
	IPR001849	421	515	PS50003	Pleckstrin-like
	IPR000306	554	613	PS50178	Zinc finger
	IPR001849	665	699	PS50003	Pleckstrin-like
ScanRegExp	IPR001304	560	584	PS00615	C-type lectin

Primer_f	CAAGTCTGTTACAAGCCTCTG
Primer_r	ACATTTGCATCAGCGTCCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAGTCTGTTACAAGCCTCTG
Primer_r	ACATTTGCATCAGCGTCCTCC
PCR product length	159 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles