| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00211 | 
|---|---|
| Accession No | AB037722 | 
| Description | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2, transcript variant 1 | 
| Clone name | fg06833 | 
| Vector information | |
| cDNA sequence | DNA sequence (6926 bp) Predicted protein sequence (1581 aa)  | 
| 
    
     
    Flexi ORF Clone  | 
    
    
    
     
    FXC00211
     
     
     | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA1301
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 6926 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 2024 bp | 
|---|---|
| Genome contig ID | gi89161199r_196672222 | 
| PolyA signal sequence (AATACA,-25)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (100000 - 99951)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 2 | r | 196772222 | 197165580 | 29 | 99.5 | Perfect prediction | 
 
        Length: 1581 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR000008 | 196 | 291 | PF00168 | C2 calcium-dependent membrane targeting | 
| IPR001202 | 818 | 847 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 996 | 1025 | PF00397 | WW/Rsp5/WWP | |
| IPR000569 | 1276 | 1581 | PF00632 | HECT | |
| HMMSmart | IPR000008 | 195 | 306 | SM00239 | C2 calcium-dependent membrane targeting | 
| IPR001202 | 817 | 849 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 995 | 1027 | SM00456 | WW/Rsp5/WWP | |
| IPR000569 | 1244 | 1581 | SM00119 | HECT | |
| ProfileScan | IPR000008 | 195 | 291 | PS50004 | C2 calcium-dependent membrane targeting | 
| IPR001202 | 816 | 849 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 994 | 1027 | PS50020 | WW/Rsp5/WWP | |
| IPR000569 | 1246 | 1581 | PS50237 | HECT | |
| ScanRegExp | IPR001202 | 822 | 847 | PS01159 | WW/Rsp5/WWP | 
| IPR001202 | 1000 | 1025 | PS01159 | WW/Rsp5/WWP | 
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | GACATGGTTCCAGTGGCTTAC | 
|---|---|
| Primer_r | AACATAACAAGGTCTGCATCG | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 2
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | AGACACAGGGACTTCCGATGC | 
| Primer_r | TGGTCACACTCTCATTGCAGG | 
| PCR product length | 212 bp | 
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |