| ROUGE |
Gene/Protein Characteristic Table for mKIAA1278 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173142 |
|---|---|
| serine/threonine kinase 36. | |
| mfj16286 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5379 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2091 bp Genome contig ID gi65488608f_74803963 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TTCTGTCCTTCCTTAATTAAAGGTTTTAAGAAATGFlanking genome sequence
(135398 - 135447) ----+----*----+----*----+----*----+----*----+----*
AAAGATGAGTGTGATTATCTGTATTTTATAAGGAGTTTTCTCATCTACTG
KIAA Alignment based on: KIAA1278 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 98..880, 892..3171, 3560..4027, 4062..4346
Length: 1271 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |