ROUGE

Gene/Protein Characteristic Table for mKIAA1202

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173129
Description :
Clone Name :	mia20043 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 8181 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3731 bp

Genome contig ID gi66880665f_4787206
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TCAAGGACCATACTTCAATAAAAGGTGCTAAGGAC
Flanking genome sequence
(160144 - 160193)
----+----*----+----*----+----*----+----*----+----*
AAAAGGACTCGTCTCTGATGTTTTGCTTGTGGCATTGAAATCCTCTAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1202 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1202	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 263..4450
Length: 1395 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM20542	100.0	shroom family m...	Mus musculus
EDL33881	95.2	mCG49121 [Mus m...	Mus musculus
XP_855411	73.5	similar to shro...	Canis lupus fam...
XP_228786	91.3	similar to shro...	Rattus norvegicus
XP_001496242	74.5	shroom family m...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129371	6e-20	26.1	mKIAA1481

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 782 849 PS50311 NULL

NULL 1030 1107 PS50322 NULL

ScanRegExp IPR007087 815 839 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	782	849	PS50311	NULL
NULL	1030	1107	PS50322	NULL
ScanRegExp	IPR007087	815	839	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3731 bp
Genome contig ID	gi66880665f_4787206
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCAAGGACCATACTTCAATAAAAGGTGCTAAGGAC
Flanking genome sequence (160144 - 160193)	----+--------+--------+--------+--------+----* AAAAGGACTCGTCTCTGATGTTTTGCTTGTGGCATTGAAATCCTCTAATA

Gene/Protein Characteristic Table for mKIAA1202

Features of the cloned DNA sequence

Features of the protein sequence