| Order Kazusa clone(s) from :  Japan
 || 
Other countries | 
| Product ID | ORK00765 | 
|---|---|
| Accession No | AB033028 | 
| Description | shroom family member 4, transcript variant 1 | 
| Clone name | fg03353 | 
| Vector information | |
| cDNA sequence | DNA sequence (6014 bp) Predicted protein sequence (1502 aa) | 
| 
    HaloTag ORF Clone | 
    FHC00765
       | 
| Flexi ORF Clone | FXC00765 | 
| Source | Human fetal brain | 
| Rouge ID | mKIAA1202
    
    by Kazusa Mouse cDNA Project | 
 Length: 6014 bp
 Length: 6014 bp Physical map
 Physical map 
     Restriction map
 Restriction map Prediction of protein coding region (GeneMark analysis).
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
 Integrity of 3' end
    | Length of 3'UTR | 1491 bp | 
|---|---|
| Genome contig ID | gi89161218r_50251844 | 
| PolyA signal sequence (AAGAAA,-29) | +----*----+----*----+----*----+---- | 
| Flanking genome sequence (99543 - 99494) | ----+----*----+----*----+----*----+----*----+----* | 
 Length: 1502 aa
 
        Length: 1502 aa Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of motif / domain search (InterProScan and SOSUI)
	Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
 Result of InterProScan
|  RT-PCR-ELISA | 
 
 Experimental conditions
 Experimental conditions| Primer_f | TCTACCCTTACCTTTCCCAGC | 
|---|---|
| Primer_r | TGAAACAAGAGGTGGTAGGAC | 
| PCR conditions | 95 °C  30 sec  55 °C  30 sec  72 °C  60 sec  30 cycles  | 
 Chromosome No. 1
 Chromosome No. 1 Experimental conditions
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | TCTACCCTTACCTTTCCCAGC | 
| Primer_r | TGAAACAAGAGGTGGTAGGAC | 
| PCR product length | 112 bp | 
| PCR conditions | 95 °C  15 sec  64 °C  60 sec  30 cycles | 
 Japan
 || 
Other countries
Japan
 || 
Other countries