ROUGE

Gene/Protein Characteristic Table for mKIAA1119

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173102
Description :	Myosin Vb (Fragment).
Clone Name :	mbg09290 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5426 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 353 bp

Genome contig ID gi65551972f_74850045
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
GTTCAAACTGAGATAATATTAAAAACACATGACGT
Flanking genome sequence
(155953 - 156002)
----+----*----+----*----+----*----+----*----+----*
AAATTGCCTTTGTGGGTCTTTCAAGAAATGATGGGACTAATAACCATAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1119 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1119	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..853, 3550..5073
Length: 791 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL09522	100.0	myosin Vb, isof...	Mus musculus
EDL82886	97.7	myosin 5B, isof...	Rattus norvegicus
P70569	97.3	Myosin-Vb; Myos...	Rattus norvegicus
Q9ULV0	92.6	Myosin-Vb.	Homo sapiens
EAW62953	92.5	acetyl-Coenzyme...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
M26251	0.00066	25.0	mKIAA4148

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002710 618 762 PD003376 Dilute

HMMPfam IPR002710 623 728 PF01843 Dilute

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002710	618	762	PD003376	Dilute
HMMPfam	IPR002710	623	728	PF01843	Dilute

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	353 bp
Genome contig ID	gi65551972f_74850045
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GTTCAAACTGAGATAATATTAAAAACACATGACGT
Flanking genome sequence (155953 - 156002)	----+--------+--------+--------+--------+----* AAATTGCCTTTGTGGGTCTTTCAAGAAATGATGGGACTAATAACCATAAG

Gene/Protein Characteristic Table for mKIAA1119

Features of the cloned DNA sequence

Features of the protein sequence