Gene/Protein Characteristic Table for mKIAA4148

Length: 1536 bp

Restriction map

Length of 3'UTR	37 bp
Genome contig ID	gi66880554f_13390344
PolyA signal sequence (None)	+----*----+----*----+----*----+---- ATTGCACACACTTGGTGCAACAGTGCAGTACCAGC
Flanking genome sequence (108219 - 108268)	----+----*----+----*----+----*----+----*----+----* AAGAAGGAAAAAAAAATCGTATCTTAGGAAAACAGCTTTCAAGTGCCTTT

Coding region: 3..1496

Length: 498 aa

Entry Exp ID% Protein Source P20152 7e-132 100.0 Vimentin. Mus musculus AAA40555 1.1e-131 99.8 vimentin protein. Mus musculus CAA39807 1.1e-131 99.8 vimentin [Mus m... Mus musculus BAE31653 1.1e-131 99.8 unnamed protein... Mus musculus EDL78721 1.2e-131 99.8 vimentin, isofo... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122388 1.6e-23 43.2 mKIAA0845

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006821	38	133	PF04732	Intermediate filament
	IPR001664	134	442	PF00038	Intermediate filament protein
ProfileScan	NULL	34	105	PS50324	NULL
ScanRegExp	IPR001664	429	437	PS00226	Intermediate filament protein

Method	From	To	amino acid sequence
-	-	-	-