| ROUGE |
Gene/Protein Characteristic Table for mKIAA0835 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AB093267 |
|---|---|
| myelin transcription factor 1. neural zinc finger protein NZF-2b. neural zinc finger transcription factor 2. |
|
| mfj01048 [Vector Info] | |
| Source : | Mouse fetal brain |
| Note : | We replaced meh02611, former representative clones for mKIAA0835 with mfj01048. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5119 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1728 bp Genome contig ID gi66880554f_181399496 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GGTGATTTCTAATAAAAGTCTCACTGTGCATAGGTFlanking genome sequence
(145235 - 145284) ----+----*----+----*----+----*----+----*----+----*
GCTATGGTCTGTGAGGAGGCTGCTACTCTGATCCTTATGTTTCTGGGAGT
KIAA Alignment based on: KIAA0835 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..3391
Length: 1129 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |