ROUGE |
Gene/Protein Characteristic Table for mKIAA1081 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122437 |
---|---|
Rab6-interacting protein 2. | |
mbg07127 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6032 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 5170 bp Genome contig ID gi65504368r_119903071 PolyA signal sequence
(TATAAA,-13) +----*----+----*----+----*----+----
CAAACTAAATCCATCAGGAAATTATAAACTTATTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAACTGTGTGCTGCAGCCTTCTTGAGTCTATCCTAGTCTGGTCACATC
KIAA Alignment based on: KIAA1081 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 2..859, 876..1229
Length: 403 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |