ROUGE |
Gene/Protein Characteristic Table for mKIAA1077 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129278 |
---|---|
Extracellular sulfatase Sulf-1 precursor. | |
mpm06017 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4436 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1535 bp Genome contig ID gi65488608f_12721239 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GGGAATAAGCAATAAATAAAGCAAGAATGACCGGCFlanking genome sequence
(267849 - 267898) ----+----*----+----*----+----*----+----*----+----*
TCTCTCTGTGCTTGCTAGATAGACGCTCACACTGCTGACGCTCGGGTGCC
KIAA Alignment based on: KIAA1077 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 196..2898, 2900..3688
Length: 1163 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |