Order Kazusa clone(s) from : ![]() |
Product ID | ORK07023 |
---|---|
Accession No | AB029000 |
Description | sulfatase 1 |
Clone name | hj06803 |
Vector information | |
cDNA sequence | DNA sequence (4834 bp) Predicted protein sequence (818 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1077
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2377 bp |
---|---|
Genome contig ID | gi51511724f_70550758 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (184945 - 184994) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 70650758 | 70735701 | 18 | 100.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GCTCCACAATTTCAACATACC |
---|---|
Primer_r | GAATAGGAGGGTACTGATGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |